This readme.txt file was generated on 2024-06-11 by Keith Alan Berggren


GENERAL INFORMATION

1. Title of Dataset: Mettl14-deletion related liver damage and nuclear heterotypia

2. Author Information
	A. Principal Investigator Contact Information
		Name: Alexander Ploss
		Institution: Princeton University
		Address: Department of Molecular Biology, Lewis Thomas Laboratory, Washington Road, Princeton, NJ 08540
		Email: aploss@princeton.edu

	B. Associate or Co-investigator Contact Information
		Name: Keith Alan Berggren
		Institution: Princeton University
		Address: Department of Molecular Biology, Lewis Thomas Laboratory, Washington Road, Princeton, NJ 08540
		Email: 

3. Date of data collection (range): 2019-05-01 through 2024-04-22

4. Geographic location of data collection: Princeton, NJ; New York, NY; Boston, MA; Raleigh, NC

5. Information about funding sources that supported the collection of the data: 
National Institute of Allergy and Infectious Diseases (NIAID)
	R01 AI138797 (to A.P)
	R01 AI153236 (to A.P.)
	R01 AI146917 (to A.P.)
	R01 AI168048 (to A.P.)
	R01 AI107301(to A.P.)
National Institute of Digestive Diseases and Kidney (NIDDK)
	R01DK121072 (to R.E.S)
National Institutes of Health Office of the Director
	S10-OD026983 (to N.A.C).
	SS10-OD030269 (to N.A.C).
National Institute of General Medical Sciences (NIGMS)
	Predoctoral training grant T32GM007388 (to K.A.B., M.P.S., S.M.)
National Cancer Institute
	P30CA072720
Burroughs Welcome Fund 
	Investigators in Pathogenesis award 101539 (to A.P.)
Damon Runyon Cancer Research Foundation
	Postdoctoral fellowship DRG-2432-21 (to A.E.L.)
New Jersey Commission on Cancer Research (NJCCR)
	Postdoctoral fellowship COCR24PDF002 (to Y.L.)
	Predoctoral fellowship COCR23PRF008 (to S.M.)
Princeton University Catalysis Initiative (to A.P. and R.K.)

SHARING/ACCESS INFORMATION

1. Licenses/restrictions placed on the data: CC-BY-4.0	 

2. Links to publications that cite or use the data: In progress.

3. Links to other publicly accessible locations of the data: None

4. Links/relationships to ancillary data sets: Raw RNA-Seq reads and the processed counts matrix can be accessed at NCBI GEO accession: GSE265879.
5. Was data derived from another source? yes/no: No 



DATA & FILE OVERVIEW

1. File List: Mettl14_data_for_PDC.xlsx, Excel spreadsheet with each tab showing raw data for each experiment / figure from our relevant publication in progress.

2. Relationship between files, if important: 

3. Additional related data collected that was not included in the current data package: 

4. Are there multiple versions of the dataset? No


METHODOLOGICAL INFORMATION

1. Description of methods used for collection/generation of data: 
Experimental Design
Experiments were designed to specifically assess the impacts of m6A within the context of an in vivo system. Mouse models for study were obtained as described in the relevant materials and methods section below. Study of the steady state impacts in adult mice was conducted initially via histologic analysis of H&E stained liver sections to determine any gross defects, and assess the nature of any evident changes. Due to the evident gross morphologic changes in Mettl14 deficient liver tissue, we aimed to fully characterize the nature of the defects by determining whether this injury was due to improper liver organogenesis and development, or tissue maintenance and metabolism defects. To distinguish between these two effect types, we performed similar histology analysis of Mettl14 model mice over a time course of early post-natal development. Simultaneously, we developed an inducible model of gene deletion for Mettl14, described in the relevant materials and methods section, to clearly exclude any developmental effects from impacting tissue architecture or damage. Our subsequent experimental designs were focused on two specific questions: the roles of m6A machinery components in injury response and regeneration, and the mechanisms leading to the unique nuclear heterotypia phenotype seen specifically in Mettl14 deletion liver tissue.

To further probe the roles of m6A machinery components in injury response and regeneration, we imposed a suite of injuries and insults to the liver with various mechanisms of damage. Physical injury was induced via two-thirds partial hepatectomy, while chemical injury to hepatocytes was modeled by CCl4 treatment. DDC was utilized to model cholestatic disease via injury by blocking bile ducts. Finally, we modeled components of chronic hepatitis B infection by developing an HBV expressing Mettl14 deficient mouse line. While the HBV expressing mouse model does not fully model chronic infection, as these animals are tolerized to HBV and express the genome themselves rather than supporting true viral infection, aspects of chronic HBV infection such as HBV protein toxicity are represented in this model.

To better understand the mechanisms underlying the nuclear heterotypia observed in Mettl14 deletion liver tissue, we first aimed to characterize the state of these mice by transcriptomic analysis. To get better data on any changes of nuclear localization, nuclear heterotypia was further explored by flow cytometry analysis of hepatocyte nuclei ploidy. Since this can skew the data, as larger nuclei may be more fragile and less likely to be cleanly isolated from liver tissue, image analysis of confocal images of liver sections was used to quantify the nuclei size distribution in situ. Finally, due to the high autofluorescence background making antibody-based fluorescent imaging difficult in liver tissue, we derived a mouse embryonic fibroblast line with similar levels of Mettl14 knockdown in order to image subcellular localization and expression levels of Mettl14, Mettl3, and Alyref, a component of the TREX mRNA transcription and export complex.

Mice
C57BL/6 and B6.Cg-Tg(Alb-cre)21Mgn/J (Alb-cre) were obtained from the Jackson Laboratory (Bar Harbor, ME) 27. Mettl14[fl/fl], Ythdf1-/- and Ythdf12[fl/fl] (all on the C57BL/6 background) were kindly provided by Dr. Chuan He (University of Chicago, HHMI) 26 Albtm1(cre/ERT2)Mtz by Dr. Pierre Chambon (INSERM, Universite ́ Louis Pasteur) 37 and 1.3x HBV transgenic mice by Dr. Frank Chisari (Scripps Research) 61. Mettl14[fl/fl]/Alb-Cre, Ythdf2[fl/fl]/Alb-Cre and Ythdf2[fl/fl]/Alb-Cre Ythdf1-/-, Mettl14[fl/fl]/Alb-ERT2-Cre, Mettl14[fl/fl]/Alb-Cre/1.3x HBV tg mice were generated by intercrossing mice harboring the respective alleles and typing offspring with primer combinations distinguishing wild-type and mutant alleles (typing information are available upon request). 

Animal experiments were performed in accordance to a protocol (number 3063) reviewed and approved by the Institutional Animal Care and Use Committee (IACUC) at Princeton University and in accordance to IACUC protocol 2016-0047 reviewed and approved by the Weill Cornell Medical College IACUC.

Tamoxifen induction experiments
Tamoxifen induction of Alb-ERT2-Cre expressing mice was performed using a protocol adapted from the Jackson Laboratory. Tamoxifen (Sigma-Aldrich, St. Louis, MO) was dissolved in corn oil at a concentration of 20 mg/ml by shaking overnight at 37°C. Tamoxifen solution was administered by intra-peritoneal injection at a dose of approximately 75 mg/kg body mass, a standard dose of 100 ul per mouse. 5 days of consecutive once daily administration were performed to induce recombination, followed by once weekly injection for 6 weeks of total time before animals were sacrificed for experimental analysis. All materials, animal bedding, and waste was handed appropriately to avoid exposure of personnel.

Histology
During sample collection, mouse livers were perfused with PBS (Life Technologies, Carlsbad, CA) using a BD Vacutainer SafetyLok butterfly needle 23 gauge, 2/4” needle length, 12” tubing length (Becton, Dickinson and Company, Franklin Lakes, NJ) via the portal vein prior to removal to clear the liver tissue of blood and achieve cleaner histology sections. Samples were collected and placed in 4% [w/vol] PFA prepared from a 10% [w/vol] neutral buffered formalin solution (Sigma-Aldrich, St. Louis, MO) for fixation prior to paraffin embedding for histologic sectioning and staining. 

Samples from DDC and CCl4 experiments were sent to Saffron Scientific Histology Services, LLC (Carbondale, IL) for paraffin-embedding and hematoxylin and eosin (H&E) or Picrosirius Red staining. 


Separate samples were placed in OCT in plastic cassettes and frozen at -20°C. Cryostat sectioning using a CM3050S Cryostat (Leica Biosystems, Wetzlar, Germany) was performed to obtain ~5um thick sections and samples were mounted on glass slides and stained with Hoechst33342 (Invitrogen, Waltham, MA) at 5ug/ml [w/vol] for 30 minutes at room temperature prior to being sealed under glass coverslips with ProLong™ Gold Antifade Mountant (Invitrogen, Carlsbad, CA). These liver-section slides were imaged using a Nikon Ti-E microscope with Spinning Disc and Photomanipulation Module (Minato City, Tokyo, Japan), and nuclear area was analyzed using Fiji image analysis to set regions of interest around the nuclei 62.

Partial hepatectomies
After weighing animals and recording pre-operative weight, we conducted surgeries under isoflurane induction of anesthesia. Following approved IACUC protocol (number 3063), we used a surgical technique adapted from Nevzorova et al. to remove 3 lobes from the liver, representing approximately two thirds of liver mass 40. Removed tissue was weighed to confirm the amount of liver mass loss, and the peritoneal wall were closed after application of analgesic medication using discontinuous 4/0 vicryl sutures (Ethicon surgical technologies, Bridgewater, NJ). Skin was closed using surgical wound clips (Stoelting, Wood Dale, IL) rather than sutures to prevent wound re-opening from animals licking or chewing on the incision site. Animals were weighed post-operatively, and daily thereafter, with recorded weights corrected for the weight of surgical staples used. Analgesic medication was administered twice daily, in accordance with the timeframes in the approved protocol. At 2 weeks post-surgery, animals were sacrificed for collection of liver samples and analysis.

DDC and CCl4 toxicity experiments
Mice arriving from Princeton University were housed in the quarantine facility of Weill Cornell Medicine for 6 weeks before being used for liver injury experiments. All mice were under a 12-hour light: dark cycle with free access to regular food and water. Mice used for fibrosis or injury models were used at ages 10-12 months unless otherwise indicated. 
For CCl4 experiments, mice received biweekly injections of 25% [w/vol] CCL4 (Sigma-Aldrich, St. Louis, MO), diluted in corn oil at a dose of 2 μl/g, for a total of 4 weeks. 0.1% [w/w] 3,5-diethoxycarbonyl-1,4-dihydrocollidine (DDC) (Sigma-Aldrich, St. Louis, MO),  was mixed with 5053, Purina Picolab Rodent Diet 20 (Envigo, Indianapolis, IN) and given for 21 days. Animals were randomly assigned to groups. Blinding could not be performed given the nature of the experiments. All animal experiments were performed on at least two separate occasions and in accordance with the guidelines set by the Institutional Animal Care and Use Committee at Weill Cornell Medicine and approved in IACUC protocol 2016-0047.
Liver tissues were fixed in 4% [vol/vol] paraformaldehyde and sent to Saffron Scientific Histology Services, LLC (Carbondale, IL) for paraffin-embedding and hematoxylin and eosin (H&E), and Picrosirius Red staining. Stained liver sections were observed and imaged using the Axioscan 7 Slide Scanner (Zeiss, Jena, Germany) and analyzed for percent area fibrosis using ImageJ software (https://imagej.net/Image).

HBV assays
HBsAg and HBeAg antigen levels were quantified as previously described 63 from serum samples obtained by submandibular bleeds of experimental mice. Chemiluminescence immunoassays (CLIA) for both antigens were performed using HBsAg and HBeAg CLIA kits from Autobio Diagnostics (Zhengzhou, Henan, China) according to manufacturer instructions using 50µl of serum.

HBV rcDNA and pgRNA were extracted from both mouse liver tissue and serum samples using a Quick-DNA/RNA Microprep Plus Kit (Zymo Research, Irvine, CA) following the manufacturer’s instructions. Briefly, liver samples and serum samples were resuspended in 300 µl DNA/RNA Shield. Liver samples were homogenized using a TissueLyser LT bead mill (Qiagen, Venlo, The Netherlands) for three separate 2 minute cycles followed by digestion with 15 µl Proteinase K (20 mg/ml) for 30 min. 300 µl DNA/RNA lysis buffer was then added to both liver and serum samples. Samples were loaded into Zymo-Spin IC-XM columns to collect the DNA and flow-through was saved. An equal volume of ethanol was added to the flow-through to purify RNA by using the Zymo-Spin IC column. Finally, the DNA/RNA was eluted from the columns with 30 μl of nuclease-free water and concentrations were measured using a Nanodrop spectrophotometer (Thermo Fischer Scientific, Waltham, MA).

HBV rcDNA was quantified from 2 µl aliquots of HBV DNA isolated either from liver samples or blood serum was used per reaction well. We used a well-characterized HBV rcDNA qPCR system with HBV-qF (nt 1776–1797, numbered based on gt D with GenBank accession no. U95551.1): 5′-GGAGGCTGTAGGCATAAATTGG-3′, HBV-qR (nt 1881-1862, numbered based on gt D with GenBank accession no. U95551.1): 5′-CACAGCTTGGAGGCTTGAAC-3′ covering the conserved region of HBV(LLD ≈ 1.0E + 3 copies/mL) 63. Primers were kept at a final concentration of 500 nM in a 20 μl reaction volume. On a Step One Plus qPCR machine (Life Technologies), we ran the following program: denature 95 °C for 10 min, followed by 40 cycles of 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 25 s.

HBV pgRNA was quantified from HBV RNA extracted from liver tissue or serum as described above. 7.5 μl of the resultant sample was treated by DNase I (Thermo Fisher Scientific, Waltham, MA, USA) followed by reverse transcription with a specific HBV primer (5′-CGAGATTGAGATCTTCTGCGAC-3′, nt 2415–2436, numbered based on gt D with GenBank accession no. U95551.1) located in precure/core region 64 using RevertAidTM First Strand DNA Synthesis Kit (Thermo Fisher Scientific, Waltham, MA, USA). For absolute quantification, standards with 1-mer HBV target template were cloned into the TOPO-Blunt Cloning vector (Thermo Fisher, Waltham, MA, USA #450245) and copy number was calculated based on the vector molecular weight and concentration. A master mix was created containing 15 µl 2 × Taqman reaction mix (Applied Biosystems, Waltham, MA, USA), 500 nM forward and reverse primers, 200 nM probe and 3 µl synthesized cDNA in a 30 µL reaction. This master mix was then added to the samples and 10-fold serial dilution standards and the following cycling program was used to run the qPCR: 95 °C for 10 min; 45 cycles of 95 °C 15 sec and 58 °C for 45 sec.

RT-qPCRs for cellular transcripts
To assess RNA levels of Mettl14, Mettl3, and Alyref, as well as Cre and simian virus 40 (SV40) large T antigen (LT) transgenes, reverse transcription real-time qPCR was performed on RNA samples from mouse liver samples and mouse embryonic fibroblast cell culture samples. All qPCRs were performed using the Luna® Universal One-Step RT-qPCR Kit (New England Biolabs, Ipswich, MA) and a Step One Plus qPCR machine (Life Technologies, Carlsbad, CA). Mettl14 was analyzed using the forward primer (5’- GACTGGCATCACTGCGAATGA-3’) and reverse primer (5’- AGGTCCAATCCTTCCCCAGAA-3’). Mettl3 was measured using the forward primer (5’- CTGGGCACTTGGATTTAAGGAA-3’) and reverse primer (5’- TGAGAGGTGGTGTAGCAACTT-3’). Alyref was measured using forward primer (5’- GGCACCGTACAGTAGACCG-3’) and reverse primer (5’- AAGTCCAGGTTTGACACGAGC-3’). Cre levels were measured using forward primer (5’- GCGGTCTGGCAGTAAAAACTATC-3’) and reverse primer (5’- GTGAAACAGCATTGCTGTCACTT-3’). LT levels were assessed with forward primer (5’- CTGACTTTGGAGGCTTCTGG -3’) and reverse primer (5’- GGAAAGTCCTTGGGGTCTTC -3’). All transcript levels were normalized to housekeeping gene standard GAPDH, which was measured using the forward primer (5’- CCATGGAGAAGGCTGGGGC -3’) and reverse primer (5’- ATGACGAACATGGGGGCATCAG -3’). All primers were commercially obtained from Eton Biosciences (San Diego, CA). Standard reaction programs were run using the Step One software and Tm recommendations.

Transcriptomics
Liver tissue was collected from animals after perfusion with PBS via the portal vein to remove blood from tissue. RNA was extracted from bulk liver tissue using the Monarch total RNA miniprep kit (New England Biolabs, Ipswich, MA) after homogenization with steel beads using a TissueLyser LT bead mill (Qiagen, Venlo, The Netherlands). After extracting total RNA, we verified high-RNA quality by Bioanalyzer RNA Nano/Pico assay (Agilent Technologies, Santa Clara, CA).

We used 50 ng total RNA per sample for gene expression profiling. We performed bulk RNA-barcoding and sequencing (BRB-Seq) 65 with minor modifications to the reverse transcription (RT) step. We used Template Switching RT Enzyme Mix (NEB, Ipswich, MA), along with a uniquely barcoded oligo(dT)30 primer for each sample, modified to use the Illumina TruSeq Read 1 priming site instead of Nextera Read 1 66. We performed the remainder of BRB-Seq per protocol: we pooled up to 24 first-strand cDNAs into a single tube, performed Gubler-Hoffman nick translation cDNA synthesis, and tagmented cDNA with in-house-produced Tn5 67. We amplified cDNAs with 17 PCR cycles using a P5-containing primer and a distinct multiplexed i7 indexing primer (Chromium i7 Multiplex Kit, 10X Genomics, Pleasanton, CA). We performed size-selection using sequential 0.55X and then 0.75X SPRIselect (Beckman Coulter, Brea, CA), and sequenced libraries on one lane of a NovaSeq SP v1.5 flowcell (Illumina, San Diego, CA) with 28 cycles Read 1, 8 cycles Read i7, and 102 cycles Read 2.

Nuclei Isolation
Nuclei for and flow cytometry analysis were extracted from frozen liver tissue samples as previously described 68. Briefly, Samples were prepared by incubating freshly obtained liver tissue samples of approximately 1 gram in HypoThermosol® FRS solution (Sigma-Aldrich, St. Louis, MO) for 15 minutes on ice, followed by 30 minutes in CryoStor® CS10 cryopreservation medium (STEMCELL technologies, Vancouver, BC, Canada) on ice. Samples were then frozen overnight at -80 °C in a in a Mr. Frosty cryo-freezing container (Thermo Scientific, Waltham, MA). Tissue was then briefly washed in ice-cold DPBS (Thermo Scientific, Waltham, MA), minced using surgical scissors in a petri dish into small pieces, and homogenized using a glass tissue grinder dounce with the small sized pestle A (DWK Life Sciences, Wertheim, Germany). Nuclei were briefly fixed with 0.1% [w/vol] PFA (Electron Microscopy Sciences, Hatfield, PA) and separated by centrifugation at 500g for 5 minutes. Nuclei were then washed and prepared for downstream applications as appropriate.

Flow cytometry
Nuclei, isolated as described above, were prepared for flow cytometry by staining with Hoechst-3342 (Invitrogen, Waltham, MA) at 5ug/ml [w/vol] for 30 minutes at room temperature, followed by 3 washes in DPBS (Thermo Scientific, Waltham, MA)  supplemented with 5% fetal bovine serum. Flow cytometry data collection was performed using an LSRII Flow Cytometer (BD Biosciences). Data were analyzed using FlowJo software (TreeStar).

Mouse embryonic fibroblast [MEF] generation
MEFs were generated as previously described 71. Briefly, In brief, the skin biopsies were scraped to remove connective tissue, cut into smaller pieces, and digested overnight at 4°C in HBSS without Ca2+ and Mg2+ (Thermo Fisher Scientific), containing 1 ml dispase (5,000 caseinolytic units/ml; Corning) for every 9 ml of HBSS containing final concentrations of 100 mg/ml streptomycin, 100 U/ml penicillin, and 250 ng/ml amphotericin B (HyClone). After digestion, the epidermis was removed and discarded, whereas the remaining dermis was cut into smaller pieces less than a few square millimeters in area. These pieces were moistened with DMEM and pressed into a six-well plate scored with a razor blade. The dermis was maintained in DMEM containing 10% FBS and 1% vol/vol penicillin/streptomycin solution at 37°C, 5% CO2. Media was changed every 4–5 d and fibroblast growth was typically observed within 1 wk of culture. Once sufficient outgrowth had occurred, the dermis was removed from the plate and the fibroblasts expanded into larger cultures. 

To generate the immortalized dermal fibroblast cell line, γ-retroviral pseudoparticles containing a transfer plasmid encoding Simian virus 40 (SV40) large T antigen were produced in HEK293T cells. Cells were cultured on poly-L-lysine−coated 10 cm plates at 37 °C, 5% (vol/vol) CO2 in 10% FBS DMEM. At ~80% confluency, Xtremegene HP DNA transfection reagent (MilliporeSigma, 6366244001) was used per manufacturer’s directions to cotransfect the cells with 4 μg of pBABE-neo-SV40 large T, a generous gift from B. Weinberg (Addgene plasmid no. 1780); 4 μg of a plasmid containing the genes for Moloney murine leukaemia virus gag-pol; and 0.57 μg of a plasmid containing the gene for the G envelope protein of vesicular stomatitis virus. Supernatants were harvested 24, 48 and 72 h post-transfection, stored at 4 °C then pooled before passing through a 0.45 μm membrane filter (MilliporeSigma, HAWP02500). Polybrene (Sigma-Aldrich, TR-1003; final concentration, 4 μg ml−1) and HEPES (Gibco, 15630080; final concentration, 2 mM) were added to the filtered supernatants; aliquots were prepared and at −80 °C until needed. Primary dermal fibroblasts were seeded in six-well plates for transduction so that cell confluency was 30–40% at the time of transduction. The cells were ‘spinoculated’ in a centrifuge at 37 °C, 931 relative centrifugal force (r.c.f.) for 2 h with 2 ml of thawed, undiluted γ-retroviral pseudoparticles per well. The cells were subsequently kept at 37 °C, 5% (vol/vol) CO2 and the media replaced with 10% FBS DMEM 6 h post-spinoculation. The transduced cells were pooled once they achieved ~80% confluency in the six-well plate and subsequently expanded to prepare immortalized cell stocks. Cells were verified as negative for mycoplasma by testing with the MycoAlert Mycoplasma Detection Assay kit (Lonza, LT07–318) per the manufacturer’s instructions.

To establish the Mettl14 deficient MEF cell line, MEFs were transduced with VSV-G pseudotyped lentiviral particles expressing CRE recombinase. Lentivirus was generated as described above. The CRE expressing lentiviral backbone was obtained as CSW-CRE plasmid, a generous gift of Dr. Charles M. Rice, The Rockefeller University).

Immunofluorescence imaging and Image analysis
MEF cells were seeded and grown overnight on glass coverslips before being fixed with 4% PFA [w/vol.] at room temperature for 30 minutes. After fixation, cells were washed with PBS and then permeabilized at −20°C for 10 min in ice-cold 90% (v/v) methanol. Cells were washed again in PBS and blocked at room temperature for 1 hour with IF buffer [PBS supplemented with 10 % (v/v) FBS and 2 mM EDTA]. Cells were incubated overnight at 4°C in primary antibody diluted in IF-T buffer (IF buffer with 0.3 % Triton X-100). The following day, cells were washed three times in IF-T buffer, incubated at room temperature for 1 hour in secondary antibody diluted 1:100 in IF-T buffer, washed three times again, and then imaged with a confocal microscope. A polyclonal antibody was used at 1:500 for Mettl14 (Invitrogen, Waltham, MA). Monoclonal antibodies were used at 1:250 for Mettl3 [EPR18810] (Abcam, Cambridge, UK) and Alyref [EPR17942] (Abcam, Cambridge, UK).

The Hoechst-3342 channel from the images was extracted, and Cellpose 2.0 72 was used to generate segmentation, outlining the nuclei. These outlined nuclei images were then imported into the Tissue Analyzer 73 plugin of Fiji for manual inspection and correction. After corrections, the outline images were transformed into labeled images by assigning a unique label to each pixel within the nuclei boundaries using Python's scikit-image and OpenCV2 libraries. These labeled segmentation masks were utilized to calculate the size and mean intensities for each nucleus across all other channels. This was accomplished through a Python script that iterates over each labeled region, extracting masked pixels and computing their size and mean using NumPy.

Western Blot
Cells or liver tissue samples were lysed in ice-cold RIPA buffer [1% Nonidet P-40, 0.5% Deoxycholate, 150 mM NaCl, 50 mM Tris-HCl, pH 7.4,  1.5 mM MgCl2, 1 mM EGTA, 10% (v/v) glycerol] supplemented with 1x protease inhibitor cocktail (Sigma-Aldrich, St. Louis, MO), spun at 12,000 rpm for 10 min, and pellet discarded. Protein amounts were quantified with a Pierce BCA kit (Thermo Fisher Scientific, Somerset, NJ), mixed with 6x Laemmli buffer, heated at 95°C for 5 min, loaded into a 10% polyacrylamide gel, and ran at 170 V for 1 hour. Gels were transferred to a nitrocellulose membrane with a Genie Blotter (Idea Scientific, Minneapolis, Minnesota), blocked in Tris-buffered saline with 0.1% [v/v] Tween-20 with 5% [w/v] milk for 30 min at room temperature, and incubated with primary antibody for 1 hour at 4°C. Membranes were washed three times for 5 min in TBST and incubated for 30 min in either IRDye 680CW or 800CW secondary antibodies (Licor, Lincoln, NE) (1:20,000). Imaging was performed with the Li-Cor Odyssey Infrared Imaging System (Licor, Lincoln, NE).

2. Methods for processing the data: 
Transcriptomic analysis
RNAseq data was analyzed using DESEQ2 as previously described.

Gene set enrichment analysis
Transcriptomic data was analyzed by GSEA software 69,70. Analyses were performed using the MSigDB M2 curated mouse gene set database (https://www.gsea-msigdb.org/gsea/msigdb/). This gene set was chosen since we were looking for specific mechanisms of RNA metabolism or specific steps of metabolism important to liver function and cell cycle regulation, rather than general signaling pathways and pro-cancer gene sets which were strongly represented in other gene set databases such as the hallmark MH gene set database.

Statistical analysis
An unpaired-student’s T-test was used to compare groups to wild-type in figures 3B, 4B, 5B,C,D, 6B, 7B,C. A paired student’s T-test was used to compare weight changes over time to wild-type baseline in partial hepatectomy recoveries in figure 3C. P-values of 0.05 or less were considered significant. Transcriptomic analysis using DESeq2 determined significance by using Benjamini and Hochberg method-corrected Wald Test P values (Fig 2, Supplemental Data 1). P-adj values of 0.1 or less were considered as hits for this analysis. The regression analysis to compare known m6A modified sites 30 with DEG fold-change expression was done using internal statistics tools in Graphpad Prism software to determine non-linear regression to a second order polynomial (quadratic), to determine a best fit model to the data. A P-value of <0.0001 and R-squared of 0.05239 was recorded for the alternative hypothesis (B0 unconstrained), and a R-squared value of -0.4864 was recorded for the null hypothesis (B0 = 0). GSEA software was used for gene set enrichment analysis 70, and P-values are derived by permutation using the standard 100 permutation default setting. We included data from gene-sets reported with p-values over the significance cut off as well to give a more complete picture of the pathways represented by significant DEGs, even when the number of related DEGs was somewhat low for a pathway. P-values and number of DEGS found for each gene set listed are shown in the figures (Fig. 2E,F). All graphs of plotted data were plotted in GraphPad Prism 10.

3. Instrument- or software-specific information needed to interpret the data: 
4. Standards and calibration information, if appropriate: 

5. Environmental/experimental conditions: Standard mouse handing, as described in our IACUC protocol, and tissue culture as previously described. Experimental conditions are described in the experiment-specific methods listed above.

6. Describe any quality-assurance procedures performed on the data: 
RNA quality-control was performed with an Agilent 2100 Bioanalyzer.

7. People involved with sample collection, processing, analysis and/or submission: 
Sample collection was performed by Keith Berggren and Saloni Sinha. Processing and analysis was performed by Keith Berggren, Saloni Sinha, Aaron Lin, Michael Schwoerer, Stephanie Maya, Abhishek Biswas, Thomas Cafiero, Yongzhen Liu, Hans Gertje, Saori Suzuki, Andrew Berneshawi, Sebastian Carver, Brigitte Heller, Nora Hassan, Qazi Ali, Daniel Beard, Danyang Wang, John Cullen, Ralph Kleiner, Nicholas Crossland, Robert Schwartz, and Alexander Ploss. Submission was performed by Keith Berggren and Alexander Ploss.

DATA-SPECIFIC INFORMATION FOR: Mettl14_data_for_PDC.xlsx Tab: Sup.Data1 DESeq2 results (Fig2)

1. Number of variables: 8

2. Number of cases/rows: 55419

3. Variable List: Gene Name, baseMean, log2FoldChange, lfcSE, stat, pvalue, padj, -log10 padj

4. Missing data codes: 
NA: No data
#VALUE!: No data to fill equation for -log10padj

5. Specialized formats or other abbreviations used:
lfcSE: The standard error estimate for the log2 fold change estimate
stat: test statistic for a given transcript
pvalue: p-value as determined by student's t-test
padj: Benjamini-hochberg adjusted p-value

DATA-SPECIFIC INFORMATION FOR: Mettl14_data_for_PDC.xlsx Tab: Sup.Data2 GSEA results (Fig2)

1. Number of variables: 22

2. Number of cases/rows: 1273

3. Variable List: Shorthand Name for Figure, GS, GS DETAILS, SIZE, ES, NES, NOM p-val, FDR q-val, FWER p-val, RANK AT MAX, LEADING EDGE, Shorthand Name for Figure, GS, GS DETAILS, SIZE, ES, NES, NOM p-val, FDR q-val, FWER p-val, RANK AT MAX, LEADING EDGE								
4. Missing data codes: 

5. Specialized formats or other abbreviations used:
GS: Gene set
ES: Enrichment score
NES: Normalized enrichment score
NOM: Nominal
FDR q-val: False-discovery rate q-value
FWER p-val: family-wise error rare p-value adjustment

DATA-SPECIFIC INFORMATION FOR: Mettl14_data_for_PDC.xlsx Tab: m6A peaks by DEGs (Fig2)

1. Number of variables: 3

2. Number of cases/rows: 171

3. Variable List: Gene symbol, log2foldchange, Number of m6A Peaks (From: Liang Z, Ye H, Ma J, Wei Z, Wang Y, Zhang Y, Huang D, Song B, Meng J, Rigden DJ, Chen K. m6A-Atlas v2.0: updated resources for unraveling the N6-methyladenosine (m6A) epitranscriptome among multiple species. Nucleic Acids Res. 2024 Jan 5;52(D1):D194-D202. doi: 10.1093/nar/gkad691. PMID: 37587690; PMCID: PMC10768109.)							
4. Missing data codes: #N/A

5. Specialized formats or other abbreviations used: None

DATA-SPECIFIC INFORMATION FOR: Mettl14_data_for_PDC.xlsx Tab: 2-3 Hep. Liver weights (Fig3)

1. Number of variables: 10

2. Number of cases/rows: 16

3. Variable List: Females: Mettl14[fl/fl] Alb-Cre+, Ythdf1 KO, Ythdf2[fl/fl] Alb-Cre+, Ythdf1 KO Ythdf2[fl/fl] Alb-Cre+, Control. Males: Mettl14[fl/fl] Alb-Cre+, Ythdf1 KO, Ythdf2[fl/fl] Alb-Cre+, Ythdf1 KO Ythdf2[fl/fl] Alb-Cre+, Control.
4. Missing data codes: 
None

5. Specialized formats or other abbreviations used:
[fl/fl]: flanking lox sites inserted into allele
Alb-Cre: Albumin-promoter expressed cre transgene expression
KO: knock-out

DATA-SPECIFIC INFORMATION FOR: Mettl14_data_for_PDC.xlsx Tab: 2-3 Hep. recovery (Fig3)

1. Number of variables: 17 genotypes, up to 12 replicates per genotype.

2. Number of cases/rows: 16

3. Variable List: Females: Mettl14[fl/fl] Alb-Cre+, Ythdf1 KO, Ythdf2[fl/fl] Alb-Cre+, Ythdf1 KO Ythdf2[fl/fl] Alb-Cre+, Control. Males: Mettl14[fl/fl] Alb-Cre+, Ythdf1 KO, Ythdf2[fl/fl] Alb-Cre+, Ythdf1 KO Ythdf2[fl/fl] Alb-Cre+, Control.
4. Missing data codes: 
None

5. Specialized formats or other abbreviations used:
[fl/fl]: flanking lox sites inserted into allele
Alb-Cre: Albumin-promoter expressed cre transgene expression
KO: knock-out

DATA-SPECIFIC INFORMATION FOR: Mettl14_data_for_PDC.xlsx Tab: CCl4+DDC%Area Fibrosis (Fig4)

1. Number of variables: 4 experimental conditions, between 1-9 replicates per condition/genotype.

2. Number of cases/rows: 5 genotypes

3. Variable List: Females: C57BL6, Ythdf1(-/-) Ythdf2[fl/fl] Alb-Cre, Ythdf1(-/-) Ythdf2[fl/fl] Alb-Cre, Mettl14[fl/fl] Alb-Cre.
4. Missing data codes: 
None

5. Specialized formats or other abbreviations used:
C57BL6: Wild-type background mouse 
[fl/fl]: flanking lox sites inserted into allele
Alb-Cre: Albumin-promoter expressed cre transgene expression
KO: knock-out
DDC:3,5-diethoxycarbonyl-1,4-dihydrocollidine
CCL4: Carbon tetrachloride injected

DATA-SPECIFIC INFORMATION FOR: Mettl14_data_for_PDC.xlsx Tab: HBV Data (Fig5)

1. Number of variables: 6 assays: 8 variables per assay. 
2. Number of cases/rows: Up to 10 depending on assay

3. Variable List: Assays: HBV rcDNA qPCR (SERUM), HBV rcDNA qPCR (LIVER), HBV pgRNA RT-qPCR (Serum), HBV pgRNA RT-qPCR (Liver), HBeAg Elisa (Serum), HBsAg, Elisa (serum): Variables per assay: Alb-Cre -/- HBV -, Alb-Cre+/ HBV-, Alb-Cre-/- HBV+, Alb-Cre+/ HBV+. For each variable: M=Male, F=Female.
4. Missing data codes: 
None

5. Specialized formats or other abbreviations used:
rcDNA: reverse complement DNA in HBV replication cycle
pgRNA: pre-genomic RNA in HBV replication cycle.
IU: International unit
Alb-Cre: Albumin-promoter expressed cre transgene expression

DATA-SPECIFIC INFORMATION FOR: Mettl14_data_for_PDC.xlsx Tab: Nuclear Area(Confocal.) (Fig6)

1. Number of variables: 6 variables
2. Number of cases/rows: Up to 459, depending on detected nuclei per sample

3. Variable List: WT, WT, WT, Mettl14[fl/fl] Alb-Cre+, Mettl14[fl/fl] Alb-Cre+, Mettl14[fl/fl] Alb-Cre+
4. Missing data codes: 
None

5. Specialized formats or other abbreviations used:
Alb-Cre: Albumin-promoter expressed cre transgene expression

DATA-SPECIFIC INFORMATION FOR: Mettl14_data_for_PDC.xlsx Tab: Ploidy (FlowCyt.) (Fig6)

1. Number of variables: 7

2. Number of cases/rows: 4

3. Variable List: Ploidy, Mettl14[fl/fl], Mettl14[fl/fl], Mettl14[fl/fl], Mettl14[fl/fl]Alb-Cre+, Mettl14[fl/fl]Alb-Cre+, Mettl14[fl/fl]Alb-Cre+

4. Missing data codes: 
None

5. Specialized formats or other abbreviations used:
 
[fl/fl]: flanking lox sites inserted into allele
Alb-Cre: Albumin-promoter expressed cre transgene expression

DATA-SPECIFIC INFORMATION FOR: Mettl14_data_for_PDC.xlsx Tab: MEF Data (Fig7)

1. Number of variables: 3 assays: MEF Confocal Nuclear Quantification (6 variables), MEF LT and Cre expression via qPCR (8 variables), Mettl14[fl/fl] MEF+LT rt-qPCR (WT normalized expression) (6 variables).

2. Number of cases/rows: 3 assays: MEF Confocal Nuclear Quantification (40 rows), MEF LT and Cre expression via qPCR (2 rows), Mettl14[fl/fl] MEF+LT rt-qPCR (WT normalized expression) (3 rows).


3. Variable List: MEF Confocal Nuclear Quantification (WT: Mettl14, Mettl14[fl/fl]Cre+: Mettl14, WT: Mettl3, Mettl14[fl/fl]Cre+: Mettl3, WT: Alyref, Mettl14[fl/fl]Cre+: Alyref), MEF LT and Cre expression via qPCR (Mettl14[fl/fl] MEFs, Mettl[fl/fl] MEFs +LT, Mettl14[fl/fl] MEFs+LT+Cre), Mettl14[fl/fl] MEF + LT rt-qPCR (WT normalized expression) (Mettl14 Cre-, Mettl14 Cre+, Mettl3 Cre+, Cre-, Alyref Cre-, Alyref Cre+)

4. Missing data codes: 
None

5. Specialized formats or other abbreviations used:

[fl/fl]: flanking lox sites inserted into allele
Alb-Cre: Albumin-promoter expressed cre transgene expression
MEF: Mouse embryonic fibroblasts
LT: SV40 large t antigen